gRNA Design Details

Target DNA Sequence
GATCAAACGGGTGAAGGACT
PAM Sequence
CGG
Target locus
Chr.11: 533584 - 533606 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 92.98/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
HRAS
Entrez Gene ID
3265
Gene Name
HRas proto-oncogene, GTPase
Gene Aliases
C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras
Chromosome Location
Chr.11: 532242 - 535567 on GRCh38
UniGene ID
Hs.37003
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001130442.2 NP_001123914.1 4
NM_001318054.1 NP_001304983.1 4
NM_005343.3 NP_005334.1 4
NM_176795.4 NP_789765.1 4