gRNA Design Details

Target DNA Sequence
GTCCTCTGGAAGAGTGTTCG
PAM Sequence
AGG
Target locus
Chr.16: 57655438 - 57655460 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 88.73/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ADGRG1
Entrez Gene ID
9289
Gene Name
adhesion G protein-coupled receptor G1
Gene Aliases
BFPP, BPPR, GPR56, TM7LN4, TM7XN1
Chromosome Location
Chr.16: 57619535 - 57665039 on GRCh38
UniGene ID
Hs.513633
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq XM_006721343.3 XP_006721406.1 7