gRNA Design Details

Target DNA Sequence
GGGGACTGGCCTTGAATAAA
PAM Sequence
AGG
Target locus
Chr.13: 98521808 - 98521830 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 89.03/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
STK24
Entrez Gene ID
8428
Gene Name
serine/threonine kinase 24
Gene Aliases
HEL-S-95, MST3, MST3B, STE20, STK3
Chromosome Location
Chr.13: 98450199 - 98577151 on GRCh38
UniGene ID
Hs.508514
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_003576.4 NP_003567.2 1