gRNA Design Details

Target DNA Sequence
CGATCTGGGTTTCATCTAAT
PAM Sequence
GGG
Target locus
Chr.13: 98475325 - 98475347 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 85.24/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
STK24
Entrez Gene ID
8428
Gene Name
serine/threonine kinase 24
Gene Aliases
HEL-S-95, MST3, MST3B, STE20, STK3
Chromosome Location
Chr.13: 98450199 - 98577151 on GRCh38
UniGene ID
Hs.508514
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001032296.3 NP_001027467.2 4
NM_001286649.1 NP_001273578.1 3
NM_003576.4 NP_003567.2 4
XM_005254079.4 XP_005254136.1 4
XM_017020794.1 XP_016876283.1 4
XM_017020795.1 XP_016876284.1 4