gRNA Design Details

Target DNA Sequence
TTGTGGCTTCTGTGCACGCT
PAM Sequence
CGG
Target locus
Chr.15: 40844618 - 40844640 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 88.75/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
SPINT1
Entrez Gene ID
6692
Gene Name
serine peptidase inhibitor, Kunitz type 1
Gene Aliases
HAI, HAI1, MANSC2
Chromosome Location
Chr.15: 40844018 - 40857655 on GRCh38
UniGene ID
Hs.233950
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001032367.1 NP_001027539.1 1
NM_003710.3 NP_003701.1 2
NM_181642.2 NP_857593.1 2
XM_006720657.1 XP_006720720.1 2
XM_011521957.1 XP_011520259.1 2
XM_011521958.1 XP_011520260.1 2