gRNA Design Details

Target DNA Sequence
TTTCCGCATGACACTTTCGA
PAM Sequence
CGG
Target locus
Chr.19: 14390944 - 14390966 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 91.71/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ADGRE5
Entrez Gene ID
976
Gene Name
adhesion G protein-coupled receptor E5
Gene Aliases
CD97, TM7LN1
Chromosome Location
Chr.19: 14381144 - 14408725 on GRCh38
UniGene ID
Hs.466039
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001784.4 NP_001775.2 4