gRNA Design Details

Target DNA Sequence
ACCACCCCGATGATCAGAGA
PAM Sequence
GGG
Target locus
Chr.15: 67208602 - 67208624 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 91.9/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
AAGAB
Entrez Gene ID
79719
Gene Name
alpha- and gamma-adaptin binding protein
Gene Aliases
KPPP1, PPKP1, PPKP1A, p34
Chromosome Location
Chr.15: 67200675 - 67255198 on GRCh38
UniGene ID
Hs.254642
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001271885.1 NP_001258814.1 7
NM_001271886.1 NP_001258815.1 7
NM_024666.4 NP_078942.3 7
XM_011522020.1 XP_011520322.1 7