gRNA Design Details

Target DNA Sequence
CTACCTCGGGATGAATGAGA
PAM Sequence
AGG
Target locus
Chr.13: 21681106 - 21681128 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 90.24/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
FGF9
Entrez Gene ID
2254
Gene Name
fibroblast growth factor 9
Gene Aliases
FGF-9, GAF, HBFG-9, HBGF-9, SYNS3
Chromosome Location
Chr.13: 21671076 - 21704501 on GRCh38
UniGene ID
Hs.111
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_002010.2 NP_002001.1 2
XM_011534996.2 XP_011533298.1 2