gRNA Design Details

Target DNA Sequence
GGTGATAATGACAGCCACCA
PAM Sequence
AGG
Target locus
Chr.12: 1754440 - 1754462 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.07/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ADIPOR2
Entrez Gene ID
79602
Gene Name
adiponectin receptor 2
Gene Aliases
ACDCR2, PAQR2
Chromosome Location
Chr.12: 1690981 - 1788679 on GRCh38
UniGene ID
Hs.371642
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_024551.2 NP_078827.2 2
XM_005253789.1 XP_005253846.1 2
XM_006719018.2 XP_006719081.1 3
XM_011521024.2 XP_011519326.1 3