gRNA Design Details

Target DNA Sequence
GTGGTGACAGACTATGCTGA
PAM Sequence
GGG
Target locus
Chr.2: 218673885 - 218673907 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 88.38/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
STK36
Entrez Gene ID
27148
Gene Name
serine/threonine kinase 36
Gene Aliases
FU
Chromosome Location
Chr.2: 218672026 - 218702717 on GRCh38
UniGene ID
Hs.471404
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001243313.1 NP_001230242.1 4
NM_015690.4 NP_056505.2 4
XM_005246464.1 XP_005246521.1 4
XM_011510959.1 XP_011509261.1 4
XM_011510960.1 XP_011509262.1 4
XM_017003804.1 XP_016859293.1 4
XM_017003805.1 XP_016859294.1 3