gRNA Design Details

Target DNA Sequence
GTACTCCCCACATGGTCCAT
PAM Sequence
GGG
Target locus
Chr.11: 61290902 - 61290924 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 91.22/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
VWCE
Entrez Gene ID
220001
Gene Name
von Willebrand factor C and EGF domains
Gene Aliases
URG11, VWC1
Chromosome Location
Chr.11: 61258286 - 61295316 on GRCh38
UniGene ID
Hs.60640
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_152718.2 NP_689931.2 4
XM_006718460.1 XP_006718523.1 4
XM_006718462.1 XP_006718525.1 4
XM_011544817.1 XP_011543119.1 4
XM_017017340.1 XP_016872829.1 4
XM_017017341.1 XP_016872830.1 4
XM_017017342.1 XP_016872831.1 3
XM_017017343.1 XP_016872832.1 4
XM_017017344.1 XP_016872833.1 4