gRNA Design Details

Target DNA Sequence
GATGACTCTTGTGGAACCAT
PAM Sequence
AGG
Target locus
Chr.7: 130208004 - 130208026 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.39/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
SSMEM1
Entrez Gene ID
136263
Gene Name
serine rich single-pass membrane protein 1
Gene Aliases
C7orf45
Chromosome Location
Chr.7: 130205399 - 130216869 on GRCh38
UniGene ID
Hs.351816
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_145268.3 NP_660311.1 1