gRNA Design Details

Target DNA Sequence
GGGGTAAGTTGGTTCTGCTT
PAM Sequence
TGG
Target locus
Chr.7: 130216045 - 130216067 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 88.79/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
SSMEM1
Entrez Gene ID
136263
Gene Name
serine rich single-pass membrane protein 1
Gene Aliases
C7orf45
Chromosome Location
Chr.7: 130205399 - 130216869 on GRCh38
UniGene ID
Hs.351816
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_145268.3 NP_660311.1 3
XM_005250141.3 XP_005250198.1 3
XM_011515794.2 XP_011514096.1 3
XM_011515795.2 XP_011514097.1 3