gRNA Design Details

Target DNA Sequence
GAGGTACTTCAGCAGCGTGG
PAM Sequence
AGG
Target locus
Chr.2: 26183013 - 26183035 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 89.43/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GAREM2
Entrez Gene ID
150946
Gene Name
GRB2 associated regulator of MAPK1 subtype 2
Gene Aliases
FAM59B, GAREML
Chromosome Location
Chr.2: 26173091 - 26202405 on GRCh38
UniGene ID
Hs.187912
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001168241.1 NP_001161713.1 3