gRNA Design Details

Target DNA Sequence
TCATACTTAGCTGTAACACG
PAM Sequence
TGG
Target locus
Chr.16: 67909023 - 67909045 on GRCh38
Strand
Reverse
Application
Gene Knock-Out
Score: 90.1/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
PSKH1
Entrez Gene ID
5681
Gene Name
protein serine kinase H1
Gene Aliases
-
Chromosome Location
Chr.16: 67893272 - 67929678 on GRCh38
UniGene ID
Hs.513683
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_006742.2 NP_006733.1 2