gRNA Design Details

Target DNA Sequence
CAACCACACCCAGTGGTATG
PAM Sequence
AGG
Target locus
Chr.1: 227817269 - 227817291 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 86.81/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
PRSS38
Entrez Gene ID
339501
Gene Name
protease, serine 38
Gene Aliases
MPN2
Chromosome Location
Chr.1: 227815708 - 227846470 on GRCh38
UniGene ID
Hs.97604
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_183062.2 NP_898885.1 3
XM_011544175.2 XP_011542477.1 3
XM_011544176.2 XP_011542478.1 3