gRNA Design Details

Target DNA Sequence
TGACCGAGGATCAAATCCTT
PAM Sequence
TGG
Target locus
Chr.2: 219247165 - 219247187 on GRCh38
Strand
Forward
Application
Gene Knock-Out
Score: 90.37/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
STK16
Entrez Gene ID
8576
Gene Name
serine/threonine kinase 16
Gene Aliases
KRCT, MPSK, PKL12, TSF1
Chromosome Location
Chr.2: 219245469 - 219250337 on GRCh38
UniGene ID
Hs.153003
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001008910.2 NP_001008910.1 4
XM_011512067.2 XP_011510369.1 4