Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTCTGCCACTGGGGGATGACTGCA[C/G]TGGCCAGGGCCTGGAACCAATAGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601065 MIM: 606490 | ||||||||||||||||||||
Literature Links: |
AARS PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AARS - alanyl-tRNA synthetase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001605.2 | 2521 | Missense Mutation | ACT,AGT | T,S 804 | NP_001596.2 |
EXOSC6 - exosome component 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107984138 - serine/threonine-protein kinase SMG1-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |