Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGACTTGGCCTTAATAAACTCAT[C/G]AAAATAAAAGCCCTGTGTTCTGTGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604299 MIM: 601802 | |||||||||||||||||||||||
Literature Links: |
APPL1 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
APPL1 - adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012096.2 | Intron | NP_036228.1 | ||||
XM_011533583.2 | Intron | XP_011531885.1 |
HESX1 - HESX homeobox 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003865.2 | Intron | NP_003856.1 | ||||
XM_005265526.4 | Intron | XP_005265583.1 | ||||
XM_006713379.3 | Intron | XP_006713442.1 | ||||
XM_011534204.2 | Intron | XP_011532506.1 | ||||
XM_011534205.2 | Intron | XP_011532507.1 | ||||
XM_017007421.1 | Intron | XP_016862910.1 |