Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGTAAGGAAAGCAGGAATTAAGAA[C/T]TGTCCCAGCCTTTGAGTTCAAATGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610500 MIM: 602711 MIM: 603483 MIM: 603819 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKHD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKHD1 - ankyrin repeat and KH domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ANKHD1-EIF4EBP3 - ANKHD1-EIF4EBP3 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020690.5 | Intron | NP_065741.3 |
APBB3 - amyloid beta precursor protein binding family B member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EIF4EBP3 - eukaryotic translation initiation factor 4E binding protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003732.2 | Intron | NP_003723.1 |
SRA1 - steroid receptor RNA activator 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001035235.3 | Intron | NP_001030312.2 | ||||
NM_001253764.1 | Intron | NP_001240693.1 |