Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACACCGTGATGGCTCCCCCACAGA[C/T]AGGAGCTGGGGCTCTGGTGGGGGAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605166 MIM: 611213 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
FCHSD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FCHSD1 - FCH and double SH3 domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033449.2 | 1438 | UTR 3 | NP_258260.1 | |||
XM_005268524.4 | 1438 | Intron | XP_005268581.1 | |||
XM_006714803.3 | 1438 | Intron | XP_006714866.1 | |||
XM_011537698.2 | 1438 | Intron | XP_011536000.1 | |||
XM_011537700.2 | 1438 | Intron | XP_011536002.1 | |||
XM_011537701.2 | 1438 | Intron | XP_011536003.1 | |||
XM_017010013.1 | 1438 | Intron | XP_016865502.1 |
HDAC3 - histone deacetylase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RELL2 - RELT like 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130029.1 | 1438 | Silent Mutation | GAC,GAT | D,D 190 | NP_001123501.1 | |
NM_173828.4 | 1438 | Silent Mutation | GAC,GAT | D,D 190 | NP_776189.3 | |
XM_005268414.3 | 1438 | Missense Mutation | GAC,GAT | D,D 190 | XP_005268471.1 | |
XM_011537624.1 | 1438 | Missense Mutation | GAC,GAT | D,D 190 | XP_011535926.1 | |
XM_011537625.2 | 1438 | Missense Mutation | GAC,GAT | D,D 190 | XP_011535927.1 |