Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGGCAGGAACAATGGTACCAAGC[C/T]CTCAGCCTGTTCTCTTTGATTCTTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615689 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
AMIGO1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
AMIGO1 - adhesion molecule with Ig like domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ATXN7L2 - ataxin 7 like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CYB561D1 - cytochrome b561 family member D1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134400.1 | Intron | NP_001127872.1 | ||||
NM_001134402.1 | Intron | NP_001127874.1 | ||||
NM_001134403.1 | Intron | NP_001127875.1 | ||||
NM_001134404.1 | Intron | NP_001127876.1 | ||||
NM_182580.2 | Intron | NP_872386.1 | ||||
XM_005270775.2 | Intron | XP_005270832.1 | ||||
XM_005270776.3 | Intron | XP_005270833.1 | ||||
XM_005270777.2 | Intron | XP_005270834.1 | ||||
XM_011541286.2 | Intron | XP_011539588.1 | ||||
XM_011541287.2 | Intron | XP_011539589.2 | ||||
XM_017001078.1 | Intron | XP_016856567.1 | ||||
XM_017001079.1 | Intron | XP_016856568.1 |