Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGCCTCAAGGCGCGCGGCCAAGC[G/A]CTGGCGCAGCTCGTCGCTGTAGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107680 MIM: 107720 MIM: 614776 | ||||||||||||||||||||
Literature Links: |
APOA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
APOA1 - apolipoprotein A1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000039.2 | 660 | Missense Mutation | CGC,TGC | R,C 197 | NP_000030.1 | |
NM_001318017.1 | 660 | Missense Mutation | CGC,TGC | R,C 197 | NP_001304946.1 | |
NM_001318018.1 | 660 | Missense Mutation | CGC,TGC | R,C 197 | NP_001304947.1 | |
NM_001318021.1 | 660 | Missense Mutation | CGC,TGC | R,C 88 | NP_001304950.1 |
APOA1-AS - APOA1 antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APOC3 - apolipoprotein C3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIK3 - SIK family kinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |