Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGTGAGTCTGCAGCAGACACATCA[A/C]TGATGTTGCTATGGGGAGAGGAGAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614717 MIM: 613510 MIM: 612414 | ||||||||||||||||||||
Literature Links: |
ANAPC15 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANAPC15 - anaphase promoting complex subunit 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LAMTOR1 - late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_017907.2 | 360 | Missense Mutation | AGT,ATT | S,I 66 | NP_060377.1 |
LRTOMT - leucine rich transmembrane and O-methyltransferase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145307.4 | 360 | Intron | NP_001138779.1 | |||
NM_001145308.4 | 360 | Intron | NP_001138780.1 | |||
NM_001145309.3 | 360 | Intron | NP_001138781.1 | |||
NM_001145310.3 | 360 | Intron | NP_001138782.1 | |||
NM_001205138.3 | 360 | Intron | NP_001192067.1 | |||
NM_001271471.2 | 360 | Intron | NP_001258400.1 | |||
NM_001318803.1 | 360 | Intron | NP_001305732.1 | |||
NM_145309.5 | 360 | Intron | NP_660352.1 | |||
XM_006718473.3 | 360 | Intron | XP_006718536.1 | |||
XM_006718474.3 | 360 | Intron | XP_006718537.1 | |||
XM_011544847.2 | 360 | Intron | XP_011543149.1 | |||
XM_011544848.2 | 360 | Intron | XP_011543150.1 | |||
XM_017017356.1 | 360 | Intron | XP_016872845.1 | |||
XM_017017357.1 | 360 | Intron | XP_016872846.1 | |||
XM_017017358.1 | 360 | Intron | XP_016872847.1 | |||
XM_017017359.1 | 360 | Intron | XP_016872848.1 | |||
XM_017017360.1 | 360 | Intron | XP_016872849.1 |