Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAACAGTCACCATGCAGAACAAAA[C/T]GCCTGATCTTTGTTTTCATGCAATT
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 116955 MIM: 612764 | |||||||||||||||||||||||
Literature Links: |
CNBP PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CNBP - CCHC-type zinc finger nucleic acid binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001127192.1 | Intron | NP_001120664.1 | ||||
NM_001127193.1 | Intron | NP_001120665.1 | ||||
NM_001127194.1 | Intron | NP_001120666.1 | ||||
NM_001127195.1 | Intron | NP_001120667.1 | ||||
NM_001127196.1 | Intron | NP_001120668.1 | ||||
NM_003418.4 | Intron | NP_003409.1 |
ISY1 - ISY1 splicing factor homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ISY1-RAB43 - ISY1-RAB43 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |