Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGAACTGGGTCCAACGCCAGCTC[C/G]TCTATGCCTGGGCTGTGCCAGGGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609740 | ||||||||||||||||||||
Literature Links: |
PHF19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PHF19 - PHD finger protein 19 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001009936.2 | 3632 | Intron | NP_001009936.1 | |||
NM_001286840.1 | 3632 | UTR 3 | NP_001273769.1 | |||
NM_001286842.1 | 3632 | UTR 3 | NP_001273771.1 | |||
NM_001286843.1 | 3632 | Intron | NP_001273772.1 | |||
NM_015651.2 | 3632 | UTR 3 | NP_056466.1 | |||
XM_005251906.2 | 3632 | UTR 3 | XP_005251963.1 | |||
XM_011518509.2 | 3632 | UTR 3 | XP_011516811.1 | |||
XM_011518511.2 | 3632 | Intron | XP_011516813.1 | |||
XM_011518515.2 | 3632 | Intron | XP_011516817.1 | |||
XM_011518516.2 | 3632 | Intron | XP_011516818.1 | |||
XM_017014612.1 | 3632 | UTR 3 | XP_016870101.1 | |||
XM_017014613.1 | 3632 | Intron | XP_016870102.1 |
PSMD5-AS1 - PSMD5 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |