Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGGTGAGAGCGTCAGGGAAGTTGG[A/G]GGGTGTAGCAGGGGTATTGGCGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607559 | ||||||||||||||||||||
Literature Links: |
C16orf96 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C16orf96 - chromosome 16 open reading frame 96 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MGRN1 - mahogunin ring finger 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBALD1 - UBA like domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_145253.2 | 346 | Missense Mutation | CCC,TCC | P,S 73 | NP_660296.1 | |
XM_017022937.1 | 346 | Intron | XP_016878426.1 |