Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGGGCCCAGCCCTTGTCACTGAGT[C/T]GGCTGCAGTGACTCAGCGCCAAGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600659 MIM: 606422 MIM: 613701 | ||||||||||||||||||||
Literature Links: |
E2F4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
E2F4 - E2F transcription factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ELMO3 - engulfment and cell motility 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369155 - uncharacterized LOC105369155 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC29 - leucine rich repeat containing 29 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001004055.1 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | NP_001004055.1 | |
NM_012163.2 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | NP_036295.1 | |
XM_017023126.1 | 793 | Missense Mutation | CAA,CGA | Q,R 251 | XP_016878615.1 | |
XM_017023127.1 | 793 | Missense Mutation | CAA,CGA | Q,R 251 | XP_016878616.1 | |
XM_017023128.1 | 793 | Missense Mutation | CAA,CGA | Q,R 251 | XP_016878617.1 | |
XM_017023129.1 | 793 | Missense Mutation | CAA,CGA | Q,R 251 | XP_016878618.1 | |
XM_017023130.1 | 793 | Missense Mutation | CAA,CGA | Q,R 162 | XP_016878619.1 | |
XM_017023131.1 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | XP_016878620.1 | |
XM_017023132.1 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | XP_016878621.1 | |
XM_017023133.1 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | XP_016878622.1 | |
XM_017023134.1 | 793 | Missense Mutation | CAA,CGA | Q,R 138 | XP_016878623.1 |
MIR328 - microRNA 328 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |