Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAAGGCTGCTGGGGCTGCCACCTC[G/A]CTATTCCCGCATAAGCATCTGCCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 152391 MIM: 608992 MIM: 610718 MIM: 615672 | ||||||||||||||||||||
Literature Links: |
ALOX12 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALOX12 - arachidonate 12-lipoxygenase, 12S type | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ALOX12-AS1 - ALOX12 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BCL6B - B-cell CLL/lymphoma 6B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C17orf49 - chromosome 17 open reading frame 49 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142798.2 | 704 | UTR 3 | NP_001136270.1 | |||
NM_001142799.2 | 704 | UTR 3 | NP_001136271.1 | |||
NM_174893.3 | 704 | UTR 3 | NP_777553.1 |
MIR195 - microRNA 195 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR497 - microRNA 497 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR497HG - mir-497-195 cluster host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNASEK - ribonuclease K | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNASEK-C17orf49 - RNASEK-C17orf49 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |