Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTACCAGCCTGTCCCAGCTCCCACC[C/T]TGGGCCCAGCAGTCATCCCTGAATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606479 MIM: 615116 | ||||||||||||||||||||
Literature Links: |
C17orf74 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C17orf74 - chromosome 17 open reading frame 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107983988 - proteoglycan 4-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NLGN2 - neuroligin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPEM1 - spermatid maturation 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_199339.2 | 752 | Silent Mutation | CTG,TTG | L,L 243 | NP_955371.2 |