Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGGCCCCGGGGCCTGGCCTCCC[CC/TG]CATACCCCACGGAGAACTTCGCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 160793 MIM: 174761 MIM: 606802 | ||||||||||||||||||||
Literature Links: |
MYBPC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MYBPC2 - myosin binding protein C, fast type | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLD1 - DAN polymerase delta 1, catalytic subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPIB - Spi-B transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243998.1 | 334 | Intron | NP_001230927.1 | |||
NM_001243999.1 | 334 | Missense Mutation | NP_001230928.1 | |||
NM_001244000.1 | 334 | Silent Mutation | NP_001230929.1 | |||
NM_003121.4 | 334 | Missense Mutation | NP_003112.2 |