Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCTTGCTAAGGTGCATGGACAGCC[A/G]GCCAGCTACGCTTACCGTGAGCGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616442 MIM: 180662 MIM: 601303 MIM: 613583 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
OVOL3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
OVOL3 - ovo like zinc finger 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302757.1 | 456 | Silent Mutation | CCA,CCG | P,P 152 | NP_001289686.1 | |
XM_011527251.2 | 456 | Silent Mutation | CCA,CCG | P,P 78 | XP_011525553.1 | |
XM_017027190.1 | 456 | Silent Mutation | CCA,CCG | P,P 175 | XP_016882679.1 | |
XM_017027191.1 | 456 | Silent Mutation | CCA,CCG | P,P 151 | XP_016882680.1 |
POLR2I - RNA polymerase II subunit I | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006233.4 | 456 | Intron | NP_006224.1 |
TBCB - tubulin folding cofactor B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
WDR62 - WD repeat domain 62 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |