Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGTAGCCCCCCCAGCAGGTTGGT[A/G]AAGTTCGTCTTGGAGGAGTAGACCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603445 MIM: 608746 MIM: 610822 | ||||||||||||||||||||
Literature Links: |
KHSRP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KHSRP - KH-type splicing regulatory protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A23 - solute carrier family 25 member 23 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC25A41 - solute carrier family 25 member 41 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321298.1 | 267 | UTR 5 | NP_001308227.1 | |||
NM_173637.3 | 267 | Silent Mutation | NP_775908.2 | |||
XM_011527926.1 | 267 | Silent Mutation | XP_011526228.1 |