Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCGGTGTAGGCAAAGTGGCCGGAGA[C/T]ATCTTCAAGGACAACGTGGTGCTGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609826 MIM: 602660 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CYSRT1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CYSRT1 - cysteine rich tail 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RNF224 - ring finger protein 224 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC34A3 - solute carrier family 34 member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001177316.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | NP_001170787.1 | |
NM_001177317.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | NP_001170788.1 | |
NM_080877.2 | 507 | Silent Mutation | GAC,GAT | D,D 107 | NP_543153.1 | |
XM_011518257.2 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_011516559.1 | |
XM_011518258.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_011516560.1 | |
XM_011518259.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_011516561.1 | |
XM_011518260.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_011516562.1 | |
XM_011518261.2 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_011516563.1 | |
XM_017014290.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_016869779.1 | |
XM_017014291.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_016869780.1 | |
XM_017014292.1 | 507 | Silent Mutation | GAC,GAT | D,D 107 | XP_016869781.1 |
TUBB4B - tubulin beta 4B class IVb | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |