Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCGCCGCGGGTGCACCCTGGGGT[G/T]TGTGCTGTGGCTGCTGCTGCTTTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616163 MIM: 610418 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DHRS12 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DHRS12 - dehydrogenase/reductase 12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031719.2 | 1161 | UTR 3 | NP_001026889.1 | |||
NM_001270424.1 | 1161 | Intron | NP_001257353.1 | |||
NM_024705.2 | 1161 | Intron | NP_078981.1 | |||
XM_005266527.3 | 1161 | Intron | XP_005266584.1 | |||
XM_005266528.4 | 1161 | Intron | XP_005266585.1 | |||
XM_011535235.2 | 1161 | UTR 3 | XP_011533537.1 | |||
XM_011535236.2 | 1161 | UTR 3 | XP_011533538.1 | |||
XM_011535237.1 | 1161 | UTR 3 | XP_011533539.1 | |||
XM_011535238.1 | 1161 | UTR 3 | XP_011533540.1 | |||
XM_017020749.1 | 1161 | Intron | XP_016876238.1 | |||
XM_017020750.1 | 1161 | Intron | XP_016876239.1 | |||
XM_017020751.1 | 1161 | Intron | XP_016876240.1 | |||
XM_017020752.1 | 1161 | Intron | XP_016876241.1 | |||
XM_017020753.1 | 1161 | UTR 3 | XP_016876242.1 | |||
XM_017020754.1 | 1161 | Intron | XP_016876243.1 |
WDFY2 - WD repeat and FYVE domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |