Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGAGAGGCCGTTCTTAGAGGAAGGA[C/T]GTGGTAGTAACTGGGGAAAATCCTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609243 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LRP11 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LRP11 - LDL receptor related protein 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAET1E - retinoic acid early transcript 1E | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243325.1 | 2016 | Intron | NP_001230254.1 | |||
NM_001243327.1 | 2016 | Intron | NP_001230256.1 | |||
NM_001243328.1 | 2016 | Intron | NP_001230257.1 | |||
NM_139165.2 | 2016 | Intron | NP_631904.1 | |||
XM_011535475.2 | 2016 | Intron | XP_011533777.1 | |||
XM_011535476.2 | 2016 | Intron | XP_011533778.1 | |||
XM_011535478.2 | 2016 | Intron | XP_011533780.1 | |||
XM_011535479.2 | 2016 | Intron | XP_011533781.1 | |||
XM_017010285.1 | 2016 | UTR 3 | XP_016865774.1 | |||
XM_017010286.1 | 2016 | UTR 3 | XP_016865775.1 | |||
XM_017010287.1 | 2016 | UTR 3 | XP_016865776.1 | |||
XM_017010288.1 | 2016 | Intron | XP_016865777.1 |
RAET1E-AS1 - RAET1E antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |