Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACCCCCAGATAGACTTACGATCT[G/A]TACTGGGATTTCCCAGCAGAAGAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601015 MIM: 609999 | ||||||||||||||||||||
Literature Links: |
MIR4709 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR4709 - microRNA 4709 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NPC2 - NPC intracellular cholesterol transporter 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006432.3 | 543 | Nonsense Mutation | CAG,TAG | Q,* 146 | NP_006423.1 | |
XM_017020930.1 | 543 | Nonsense Mutation | CAG,TAG | Q,* 146 | XP_016876419.1 |
SYNDIG1L - synapse differentiation inducing 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |