Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATTGGCTGACCACCTGAATGAGGA[C/T]GTGAGTCTGACGGTCTCTAGAGGGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 612104 MIM: 608730 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ANKRD52 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ANKRD52 - ankyrin repeat domain 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NABP2 - nucleic acid binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC39A5 - solute carrier family 39 member 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001135195.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | NP_001128667.1 | |
NM_173596.2 | 659 | Silent Mutation | GAC,GAT | D,D 157 | NP_775867.2 | |
XM_005268803.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_005268860.1 | |
XM_011538198.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_011536500.1 | |
XM_011538199.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_011536501.1 | |
XM_011538200.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_011536502.1 | |
XM_011538201.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_011536503.1 | |
XM_017019185.1 | 659 | Silent Mutation | GAC,GAT | D,D 157 | XP_016874674.1 | |
XM_017019186.1 | 659 | UTR 5 | XP_016874675.1 | |||
XM_017019187.1 | 659 | UTR 5 | XP_016874676.1 |