Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTTGGGGACTGAGGGTCCCAGCT[C/T]GTTTCTGTGCTCCGTCCTGTGGATG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614770 MIM: 601717 MIM: 610850 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PCP2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PCP2 - Purkinje cell protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271830.1 | 317 | Missense Mutation | CAA,CGA | Q,R 87 | NP_001258759.1 | |
NM_174895.2 | 317 | Missense Mutation | CAA,CGA | Q,R 103 | NP_777555.1 | |
XM_006722639.2 | 317 | Missense Mutation | CAA,CGA | Q,R 66 | XP_006722702.1 | |
XM_017026249.1 | 317 | Missense Mutation | CAA,CGA | Q,R 219 | XP_016881738.1 | |
XM_017026250.1 | 317 | Missense Mutation | CAA,CGA | Q,R 219 | XP_016881739.1 | |
XM_017026251.1 | 317 | Missense Mutation | CAA,CGA | Q,R 103 | XP_016881740.1 | |
XM_017026252.1 | 317 | Missense Mutation | CAA,CGA | Q,R 66 | XP_016881741.1 |
PET100 - PET100 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001171155.1 | 317 | Intron | NP_001164626.1 |
STXBP2 - syntaxin binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
XAB2 - XPA binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |