Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCCCAGTGTCTCCCACAGGCGCT[G/T]GCCCTACGGCTCGGACGGCTGCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616103 MIM: 600342 | ||||||||||||||||||||
Literature Links: |
LRIT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LRIT1 - leucine rich repeat, Ig-like and transmembrane domains 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RGR - retinal G protein coupled receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012720.1 | 292 | Missense Mutation | TGG,TTG | W,L 81 | NP_001012738.1 | |
NM_001012722.1 | 292 | Missense Mutation | TGG,TTG | W,L 81 | NP_001012740.1 | |
NM_002921.3 | 292 | Missense Mutation | TGG,TTG | W,L 85 | NP_002912.2 |