Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCTGAAGAGGCTATCATGGAGCTG[A/G]ACCTGCCGACTGGTATTCCCATTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606493 MIM: 172250 | ||||||||||||||||||||
Literature Links: |
EXOSC1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EXOSC1 - exosome component 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC644215 - uncharacterized LOC644215 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PGAM1 - phosphoglycerate mutase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001317079.1 | 738 | Missense Mutation | AAC,GAC | N,D 194 | NP_001304008.1 | |
NM_002629.3 | 738 | Intron | NP_002620.1 |