Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGCTGGCGGCCCAGAGCAAATCC[G/T]GCAGAGGAGGGCAGAGGCGATACCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606149 MIM: 606150 | ||||||||||||||||||||
Literature Links: |
FADS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FADS2 - fatty acid desaturase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FADS3 - fatty acid desaturase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021727.4 | Intron | NP_068373.1 | ||||
XM_011545023.2 | Intron | XP_011543325.1 | ||||
XM_017017723.1 | Intron | XP_016873212.1 | ||||
XM_017017724.1 | Intron | XP_016873213.1 |
MIR6746 - microRNA 6746 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |