Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCCCTGACCCGCGTGTCAGACGG[C/T]GAGAATGTCATTATATCCCACTTCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614177 MIM: 609059 MIM: 180530 | ||||||||||||||||||||
Literature Links: |
CRACR2B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CRACR2B - calcium release activated channel regulator 2B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PNPLA2 - patatin like phospholipase domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020376.3 | 521 | Silent Mutation | GGC,GGT | G,G 124 | NP_065109.1 | |
XM_006718265.3 | 521 | Silent Mutation | GGC,GGT | G,G 124 | XP_006718328.1 | |
XM_006718266.3 | 521 | Silent Mutation | GGC,GGT | G,G 124 | XP_006718329.1 | |
XM_017018028.1 | 521 | Silent Mutation | GGC,GGT | G,G 124 | XP_016873517.1 |
RPLP2 - ribosomal protein lateral stalk subunit P2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA52 - small nucleolar RNA, H/ACA box 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |