Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCAGCTGCTTGCTGCGGGTTTGCA[C/T]ATCCTCCTGCAGGGCATGGCACTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611947 MIM: 607146 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC153 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CCDC153 - coiled-coil domain containing 153 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145018.1 | 597 | Missense Mutation | NP_001138490.1 | |||
XM_006718818.3 | 597 | Missense Mutation | XP_006718881.1 | |||
XM_011542763.2 | 597 | Missense Mutation | XP_011541065.1 | |||
XM_011542764.2 | 597 | Missense Mutation | XP_011541066.1 | |||
XM_011542770.2 | 597 | Missense Mutation | XP_011541072.1 | |||
XM_011542771.2 | 597 | Missense Mutation | XP_011541073.1 | |||
XM_011542772.2 | 597 | Missense Mutation | XP_011541074.1 | |||
XM_011542774.2 | 597 | Missense Mutation | XP_011541076.1 | |||
XM_017017577.1 | 597 | Missense Mutation | XP_016873066.1 | |||
XM_017017578.1 | 597 | Missense Mutation | XP_016873067.1 | |||
XM_017017579.1 | 597 | Missense Mutation | XP_016873068.1 | |||
XM_017017580.1 | 597 | Missense Mutation | XP_016873069.1 |
NLRX1 - NLR family member X1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDZD3 - PDZ domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |