Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTACATCCTGCCCAATGACATCGG[C/T]GTGTCTAGCCTGGACTGCCGTGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606818 MIM: 609827 | ||||||||||||||||||||
Literature Links: |
DPP3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPP3 - dipeptidyl peptidase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256670.1 | 500 | Silent Mutation | GGC,GGT | G,G 13 | NP_001243599.1 | |
NM_005700.4 | 500 | Silent Mutation | GGC,GGT | G,G 13 | NP_005691.2 | |
NM_130443.3 | 500 | Silent Mutation | GGC,GGT | G,G 13 | NP_569710.2 |
LOC101928069 - uncharacterized LOC101928069 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PELI3 - pellino E3 ubiquitin protein ligase family member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |