Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGGGCTATAGCGGTACTTGTAGAC[C/T]ACTCGGGGGATGAACTCAGATGTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 605478 | ||||||||||||||||||||
Literature Links: |
ANO9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ANO9 - anoctamin 9 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001012302.2 | 1966 | Silent Mutation | GTA,GTG | V,V 627 | NP_001012302.2 | |
XM_011520048.1 | 1966 | Intron | XP_011518350.1 | |||
XM_011520051.2 | 1966 | Intron | XP_011518353.1 | |||
XM_011520052.2 | 1966 | Intron | XP_011518354.1 | |||
XM_011520053.2 | 1966 | Silent Mutation | GTA,GTG | V,V 328 | XP_011518355.1 | |
XM_017017644.1 | 1966 | Intron | XP_016873133.1 | |||
XM_017017645.1 | 1966 | Intron | XP_016873134.1 | |||
XM_017017646.1 | 1966 | Intron | XP_016873135.1 | |||
XM_017017647.1 | 1966 | Intron | XP_016873136.1 |
SIGIRR - single Ig and TIR domain containing | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |