Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGCTGGAGGTGTCTGCCCGGCAC[C/T]CCCAGCGCCTGGACCGCCACGGCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123590 MIM: 602179 | ||||||||||||||||||||
Literature Links: |
C11orf52 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C11orf52 - chromosome 11 open reading frame 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CRYAB - crystallin alpha B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001289807.1 | 404 | Intron | NP_001276736.1 | |||
NM_001289808.1 | 404 | Intron | NP_001276737.1 | |||
NM_001885.2 | 404 | Intron | NP_001876.1 | |||
XM_011542608.1 | 404 | Intron | XP_011540910.1 | |||
XM_011542609.2 | 404 | Intron | XP_011540911.1 |
HSPB2 - heat shock protein family B (small) member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001541.3 | 404 | Missense Mutation | CCC,TCC | P,S 104 | NP_001532.1 |
HSPB2-C11orf52 - HSPB2-C11orf52 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |