Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGGTTCAGCAGCTGCTGAAACTC[C/G]GAGTTGTCGACGGATGCCAGGTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 164014 MIM: 602180 | ||||||||||||||||||||
Literature Links: |
MIR4489 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR4489 - microRNA 4489 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RELA - RELA proto-oncogene, NF-kB subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145138.1 | 1324 | Silent Mutation | TCC,TCG | S,S 469 | NP_001138610.1 | |
NM_001243984.1 | 1324 | Silent Mutation | TCC,TCG | S,S 403 | NP_001230913.1 | |
NM_001243985.1 | 1324 | Intron | NP_001230914.1 | |||
NM_021975.3 | 1324 | Silent Mutation | TCC,TCG | S,S 472 | NP_068810.3 | |
XM_011545206.1 | 1324 | Silent Mutation | TCC,TCG | S,S 401 | XP_011543508.1 | |
XM_011545207.1 | 1324 | Silent Mutation | TCC,TCG | S,S 366 | XP_011543509.1 |
SIPA1 - signal-induced proliferation-associated 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |