Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACAGGGTGTCACCTGTTGATGAGC[A/C]CAAAGTTGAAGGTCTGTCCAGTCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610602 MIM: 191525 MIM: 612492 | ||||||||||||||||||||
Literature Links: |
ALKBH2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALKBH2 - alkB homolog 2, alpha-ketoglutarate dependent dioxygenase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001655.2 | 860 | Missense Mutation | GGG,GTG | G,V 156 | NP_001001655.1 | |
NM_001145374.1 | 860 | Missense Mutation | GGG,GTG | G,V 156 | NP_001138846.1 | |
NM_001145375.1 | 860 | Missense Mutation | GGG,GTG | G,V 156 | NP_001138847.1 | |
NM_001205179.1 | 860 | Intron | NP_001192108.1 | |||
NM_001205180.1 | 860 | Intron | NP_001192109.1 | |||
XM_005253835.4 | 860 | Missense Mutation | GGG,GTG | G,V 156 | XP_005253892.1 | |
XM_005253836.1 | 860 | Intron | XP_005253893.1 |
UNG - uracil DNA glycosylase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP30 - ubiquitin specific peptidase 30 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |