Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCTGCCACCCCATGGGCCTGCTG[C/T]TGGTGGCAGCGTGGCCGCCTCCTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607462 MIM: 615140 MIM: 176883 | ||||||||||||||||||||
Literature Links: |
ATN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATN1 - atrophin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C12orf57 - chromosome 12 open reading frame 57 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001301834.1 | 661 | Missense Mutation | GCT,GTT | A,V 119 | NP_001288763.1 | |
NM_001301836.1 | 661 | Missense Mutation | GCT,GTT | A,V 106 | NP_001288765.1 | |
NM_001301837.1 | 661 | Missense Mutation | GCT,GTT | A,V 90 | NP_001288766.1 | |
NM_001301838.1 | 661 | Missense Mutation | GCT,GTT | A,V 84 | NP_001288767.1 | |
NM_138425.3 | 661 | Missense Mutation | GCT,GTT | A,V 119 | NP_612434.1 |
PTPN6 - protein tyrosine phosphatase, non-receptor type 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002831.5 | 661 | Intron | NP_002822.2 | |||
NM_080548.4 | 661 | Intron | NP_536858.1 | |||
NM_080549.3 | 661 | Intron | NP_536859.1 | |||
XM_006718994.1 | 661 | Intron | XP_006719057.1 | |||
XM_011520988.1 | 661 | Intron | XP_011519290.1 |
RNU7-1 - RNA, U7 small nuclear 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |